Sequence ID | >W1910228378 |
Genome ID | FNOF01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula vallismortis DSM 3756 [FNOF] |
Start position on genome | 257231 |
End posion on genome | 257304 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cacctttcac |
tRNA gene sequence |
GGCAGAATGGTCAAACCTGGGTACGACACCTCCTTGGTATGGAGGAGATACGGGTTCAAA |
Downstream region at tRNA end position |
cgagcgtctt |
Secondary structure (Cloverleaf model) | >W1910228378 Thr GGT c Tttt cgagcgtctt G - C G - C C - G A - T G - C A - T A - T T A T T G C C C A C C A A G | | | | | A T A C T G A C G G G C G | | | T T G C G A C G T A A AGAT C - G C - G T - A C - G C - G T T T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |