Sequence ID | >W1910228597 |
Genome ID | FNVN01000001 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halobellus limi CGMCC 1.10331 [FNVN] |
Start position on genome | 665619 |
End posion on genome | 665545 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gtgaatgcag |
tRNA gene sequence |
GCTCGGTTGGTGTAGTCCGGCCAATCATCTTGGCCTTTCGAGCCGAGGACCAGGGTTCAA |
Downstream region at tRNA end position |
ctctcctaac |
Secondary structure (Cloverleaf model) | >W1910228597 Glu TTC g Attt ctctcctaac G - C C - G T - A C - G G - C G - C T - A T A T G T C C C A C T G A G | | | | | A C T G T G C A G G G C G | | + T T G T C A T C C A A C GGAC T - A T + G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |