Sequence ID | >W1910229729 |
Genome ID | FOCX01000031 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorientalis persicus IBRC-M 10043 [FOCX] |
Start position on genome | 18473 |
End posion on genome | 18398 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tatttctcgT |
tRNA gene sequence |
GCCTGGGAGTCCCCCGTGGTGGGGGAGCCGGGCTGTTACCCTGGTCGTGGACGGTTCGAC |
Downstream region at tRNA end position |
gggaccgcga |
Secondary structure (Cloverleaf model) | >W1910229729 Asn GTT T GTtc gggaccgcga G - C C - G C - G T - A G - C G - C G - C T C A C T G C C A G C C G | | | | | G T C C C T G A C G G C G | | | | T T G G G G A T G G G TCGTG C - G C - G G + T G - C G - C C C T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |