Sequence ID | >W1910230399 |
Genome ID | FOPZ01000005 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum aquaticum CGMCC 1.6377 [FOPZ] |
Start position on genome | 40314 |
End posion on genome | 40396 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cttcgaacga |
tRNA gene sequence |
GCCAGGATGGCCGAGTGGTAAGGCGCACGCCTGGAAAGCGTGTTCCCTTCCGGGATCGGG |
Downstream region at tRNA end position |
ttgctgtcgc |
Secondary structure (Cloverleaf model) | >W1910230399 Ser GGA a GCtt ttgctgtcgc G - C C - G C - G A - T G - C G - C A - T T A T C T C C C A G A G | + | | | A T G C C G G G G G G C G | | | T T G A G G C T A G TTCCCTTCCGGGATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |