Sequence ID | >W1910230589 |
Genome ID | FOUJ01000006 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanolobus profundi Mob M [FOUJ] |
Start position on genome | 57380 |
End posion on genome | 57293 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cagatcatgt |
tRNA gene sequence |
GCGGGGGTTGCCCAGCCAGGCCAAAGGCGCTAGGTTGAGGGCCTAGTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
caatctcttt |
Secondary structure (Cloverleaf model) | >W1910230589 Leu GAG t ACCA caatctcttt G - C C - G G - C G - C G - C G + T G - C T A T C A C A C A C C G A T | | | | | G A C C C G G T G T G C G | | | T T G A G G C C C A A G TCTCGTAGGAGTTC C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |