Sequence ID | >W1910230712 |
Genome ID | FOYS01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halogeometricum limi CGMCC 1.8711 [FOYS] |
Start position on genome | 58274 |
End posion on genome | 58203 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cggtcaccaa |
tRNA gene sequence |
GCGCCGATGGTCCAATGGTAGGACTCGGGCTTCCCAAGCCCGCGGTCCGGGTTCAATTCC |
Downstream region at tRNA end position |
acaacttctc |
Secondary structure (Cloverleaf model) | >W1910230712 Gly CCC a ACtt acaacttctc G - C C - G G - C C - G C - G G - C A - T T T T G G C C C A A A G | | | | | A T C C T G C C G G G C G | | | | T T G G G A C T A T CGGT C - G G - C G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |