Sequence ID | >W1910238305 |
Genome ID | FPMA01000001 |
Search identical group | |
Phylum/Class | Chlamydiota |
Species | Chlamydia abortus 10DC83 [FPMA] |
Start position on genome | 684554 |
End posion on genome | 684625 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttaagtatag |
tRNA gene sequence |
GCCCAGATAGCTCAGTGGTAGAGCACTTGCATGGTAAGCAAGCGGTCGTAGGTTCAATTC |
Downstream region at tRNA end position |
gtaatggttg |
Secondary structure (Cloverleaf model) | >W1910238305 Thr GGT g Agaa gtaatggttg G - C C - G C - G C - G A - T G - C A - T T T T T A T C C A G A A + | | | | A T C T C G G T A G G C G | | | | T T G G A G C T A A CGGTC C - G T - A T - A G - C C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |