| Sequence ID | >W1910282733 |
| Genome ID | FRDQ01000069 |
| Phylum/Class | Gammaproteobacteria |
| Species | Moritella viscosa [FRDQ] |
| Start position on genome | 14971 |
| End posion on genome | 15046 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
ggcaccattt |
| tRNA gene sequence |
GCCCGAATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCCCTGGTTCAATT |
| Downstream region at tRNA end position |
aataattccc |
| Secondary structure (Cloverleaf model) | >W1910282733 Phe GAA
t ACCA aataattccc
G - C
C - G
C - G
C - G
G - C
A - T
A - T T T
T G G G C C A
T G A A | | + | | A
C C T C G C C T G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
A - T
G - C
G - C
A - T
T A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |