Sequence ID | >W1910283625 |
Genome ID | FREC01000043 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecium [FREC] |
Start position on genome | 1728 |
End posion on genome | 1644 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tattatttaT |
tRNA gene sequence |
GCAGACGTGATGGAACGGCAGACATGCAAGATTGAGGGTCTTGTGAGCGTACGCTCGTGT |
Downstream region at tRNA end position |
ttctttcaaa |
Secondary structure (Cloverleaf model) | >W1910283625 Leu GAG T ATtt ttctttcaaa G - C C - G A - T G - C A - T C - G G - C T A T T A C C C A C A A G + | | | | A G G G T A G T G G G C G | | | T T C A C A T A G G TGAGCGTACGCTCGT C - G A - T A - T G - C A - T T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |