Sequence ID | >W1910284042 |
Genome ID | FREI01000014 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecium [FREI] |
Start position on genome | 12099 |
End posion on genome | 12186 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tagtacttac |
tRNA gene sequence |
GGAAGGTTGGCAGAGTGGTAATGCACCGGACTCGAAATCCGGCGAGCCGCAGTAATGTGG |
Downstream region at tRNA end position |
atatcaacga |
Secondary structure (Cloverleaf model) | >W1910284042 Ser CGA c Ttat atatcaacga G - C G - C A - T A - T G - C G - C T - A T A T T G C C C A G A G | | | | | A T G A C G A C G G G C G | | | T T G A T G C T A A CGAGCCGCAGTAATGTGGTGC C - G C - G G - C G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |