Sequence ID | >W1910313213 |
Genome ID | FRYH01000046 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli [FRYH] |
Start position on genome | 8290 |
End posion on genome | 8363 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccttctggta |
tRNA gene sequence |
TGGCGTGTAGCTCAATTGGTGAGAGCGGTTGGTTTTCAATCAAGTACATGCAGGTTCGAC |
Downstream region at tRNA end position |
gtagcttttg |
Secondary structure (Cloverleaf model) | >W1910313213 Glu TTC a Ataa gtagcttttg T - A G - C G + T C - G G - C T - A G - C T C T T G T C C A T A A A + | | | | G T C T C G G C A G G C G | | | | T T G G A G C T G A G TACAT G G T - A T - A G - C G + T T A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |