Sequence ID | >W1910335454 |
Genome ID | FSOI01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus subsp. abscessus 527 [FSOI] |
Start position on genome | 511196 |
End posion on genome | 511271 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gtctcggcac |
tRNA gene sequence |
GCCCCTATAGCTCAGTTGGTAGAGCTACGGACTTTTAATCCGCAGGTCCCAGGTTCGAGC |
Downstream region at tRNA end position |
gcagcaccgc |
Secondary structure (Cloverleaf model) | >W1910335454 Lys TTT c ACCA gcagcaccgc G - C C - G C - G C - G C - G T + G A - T C G T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C T A T AGGTC A C C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |