Sequence ID | >W1910342698 |
Genome ID | FTRE01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Bifidobacterium animalis [FTRE] |
Start position on genome | 137179 |
End posion on genome | 137106 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gtgcggtgtt |
tRNA gene sequence |
GCCCCTCTAGCTCAACGGTTAGAGCAGCGTCCTTTTAAGTCGTGGGTTCAGGGTTCGAAT |
Downstream region at tRNA end position |
tcaatttctt |
Secondary structure (Cloverleaf model) | >W1910342698 Lys TTT t ACtt tcaatttctt G - C C - G C - G C - G C - G T + G C - G T A T G T C C C A C A A A | | | | | G G C T C G C A G G G C G | | | | T T T G A G C T A A GGGTT G + T C - G G - C T T C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |