Sequence ID | >W1910364354 |
Genome ID | FUBN01000210 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shigella sonnei sh1410 [FUBN] |
Start position on genome | 3977 |
End posion on genome | 4052 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtgggccagc |
tRNA gene sequence |
GCCGACTTAGCTCAGCAGGCAGAGCAACTGACTTGTAATCAGTAGGTCACCAGTTCGATT |
Downstream region at tRNA end position |
tatgcgggca |
Secondary structure (Cloverleaf model) | >W1910364354 Thr TGT c ACCA tatgcgggca G - C C - G C - G G - C A - T C - G T - A T T T T G G C C A C G A A | | | | G A C T C G A C C A G C G | | | | T T G G A G C C A A AGGTC A - T C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |