Sequence ID | >W1910371070 |
Genome ID | FUFC01000025 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Porphyromonas gingivalis 3A1 [FUFC] |
Start position on genome | 71515 |
End posion on genome | 71440 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gaataaagat |
tRNA gene sequence |
GGTCAGGTAGCTCAGCTGGATAGAGCAATAGCCTTCTAAGCTATCGGTCCTGGGTTCGAA |
Downstream region at tRNA end position |
gaaaaaggga |
Secondary structure (Cloverleaf model) | >W1910371070 Arg TCT t ACCt gaaaaaggga G - C G + T T - A C - G A - T G - C G - C T A T G A C C C A C G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C A T A A CGGTC A - T T - A A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |