Sequence ID | >W1910385065 |
Genome ID | FUOB01000010 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile VRECD0048 [FUOB] |
Start position on genome | 5837 |
End posion on genome | 5910 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aattaaatat |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGTTCTGGCCTTCCAAGCCAGCTGTGAGGGTTCGATCCC |
Downstream region at tRNA end position |
aaaatgggac |
Secondary structure (Cloverleaf model) | >W1910385065 Gly TCC t TCCA aaaatgggac G - C C - G G - C G - C G - C T - A G - C C T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | + T T G G A G T T A T CTGT C - G T - A G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |