Sequence ID | >C141001782 |
Genome ID | CP003700 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium vincentii 3_1_36A2 [CP003700] |
Start position on genome | 246160 |
End posion on genome | 246235 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aattatttat |
tRNA gene sequence |
GCGTCATTAGCTCAGTTGGTAGAGCACACGACTTTTAATCGTGTTGTCACAAGTTCAAAT |
Downstream region at tRNA end position |
ttcaatatgt |
Secondary structure (Cloverleaf model) | >C141001782 Lys TTT t ACCA ttcaatatgt G - C C - G G - C T - A C - G A - T T - A T A T T G T T C A T G A A | | | | | A T C T C G A C A A G C G | | | | T T G G A G C T A A TTGTC C - G A - T C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |