Sequence ID | >W1910390104 |
Genome ID | FUQI01000017 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridioides difficile VRECD0185 [FUQI] |
Start position on genome | 406 |
End posion on genome | 480 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
acgtgaatat |
tRNA gene sequence |
TCCAAGGTAGCTCAATGGTGGAGCAACCGGCTGTTAACCGGTAGGCTGTGGGTTCGAGCC |
Downstream region at tRNA end position |
aaaaaagccg |
Secondary structure (Cloverleaf model) | >W1910390104 Asn GTT t GCCA aaaaaagccg T - A C - G C - G A - T A - T G - C G - C C G T C A C C C A A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T G A AGGCT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |