Sequence ID | >C141003237 |
Genome ID | CP004006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Legionella oakridgensis ATCC 33761 = DSM 21215 [CP004006] |
Start position on genome | 1439463 |
End posion on genome | 1439390 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cgtttctttt |
tRNA gene sequence |
GCGGGCGTAGTTTAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
ttttttgcct |
Secondary structure (Cloverleaf model) | >C141003237 Gly CCC t TCCA ttttttgcct G - C C - G G - C G - C G - C C - G G - C T T T T A C C C A A A A + | | | | G T T T T G G T G G G C G + | | | T T G G A A C T A T TAGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |