Sequence ID | >W1910419809 |
Genome ID | FVML01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus subsp. massiliense 1001 [FVML] |
Start position on genome | 217124 |
End posion on genome | 217035 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aggaagttca |
tRNA gene sequence |
GGAGGCGTGCCAGAGCGGCCGAATGGGACTCACTGCTAATGAGTTGTCCCCTTTACGGGG |
Downstream region at tRNA end position |
cggtctgcag |
Secondary structure (Cloverleaf model) | >W1910419809 Ser GCT a GCgt cggtctgcag G - C G - C A - T G - C G - C C - G G - C T A T T C T C C A C G A G + | | | | A G G A C C G G A G G C G | | | T T C A T G G C G A G TGTCCCCTTTACGGGGGACC A - T C - G T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |