Sequence ID | >W1910419938 |
Genome ID | FVMN01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus subsp. massiliense 999 [FVMN] |
Start position on genome | 538990 |
End posion on genome | 539064 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
agcgccgcat |
tRNA gene sequence |
GCCTCCGTAGCTCAGTTGGATAGAGCAAGGGCCTTCTAATCCCTAGGTCGCAGGTTCGAT |
Downstream region at tRNA end position |
ttcggaacag |
Secondary structure (Cloverleaf model) | >W1910419938 Arg TCT t GCtg ttcggaacag G - C C - G C - G T + G C - G C - G G - C T T T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC A - T G - C G - C G - C C T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |