Sequence ID | >C141005282 |
Genome ID | CP006585 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Megalodesulfovibrio gigas DSM 1382 = ATCC 19364 [CP006585] |
Start position on genome | 2185742 |
End posion on genome | 2185666 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tctctcgcgt |
tRNA gene sequence |
CGGGATGTAGCGCAGTTTGGGAGCGCACCTGAATGGGGTTCAGGGGGTCGAAGGTTCAAA |
Downstream region at tRNA end position |
cagatttccc |
Secondary structure (Cloverleaf model) | >C141005282 Pro GGG t ACCA cagatttccc C - G G - C G - C G - C A - T T - A G - C T A T T T T C C A T G A A + | | | | A T C G C G G A A G G C T | | | | T T G G C G C G G A A GGGTC C - G C - G T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |