Sequence ID | >C141005288 |
Genome ID | CP006585 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Megalodesulfovibrio gigas DSM 1382 = ATCC 19364 [CP006585] |
Start position on genome | 363180 |
End posion on genome | 363094 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gttgacgagt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGACACCTGTCCGTA |
Downstream region at tRNA end position |
tctttcaaaa |
Secondary structure (Cloverleaf model) | >C141005288 Leu GAG t ACCA tctttcaaaa G - C C - G C - G G - C A - T A - T G - C T G T T C C T C A T A A G | | | | | G T G G T G A G G A G C G | | | T T G A C A C T A G G TGGACACCTGTCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |