Sequence ID | >W1910422829 |
Genome ID | FVOK01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus subsp. abscessus 834 [FVOK] |
Start position on genome | 908529 |
End posion on genome | 908605 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gttcggctca |
tRNA gene sequence |
GGGGCTATAGCTCAGGCGGTTAGAGCGCTTCGCTGATAACGAAGAGGTCGGAGGTTCGAG |
Downstream region at tRNA end position |
cacttgttgg |
Secondary structure (Cloverleaf model) | >W1910422829 Ile GAT a ACCA cacttgttgg G - C G - C G - C G - C C - G T - A A - T T G T C C T C C A G G A A | | | | | G C C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |