Sequence ID | >W1910423173 |
Genome ID | FVOQ01000005 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus subsp. bolletii 1022 [FVOQ] |
Start position on genome | 213602 |
End posion on genome | 213528 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ggcttcaaag |
tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
agctgagagg |
Secondary structure (Cloverleaf model) | >W1910423173 Pro CGG g ACtg agctgagagg C - G G - C G - C G - C G - C T - A G - C T A T C G C C C A C G A G | + | | | G T C G C G G T G G G C T | | | | T T G G C G C G T A G AGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |