| Sequence ID | >C141007119 |
| Genome ID | CP006702 |
| Phylum/Class | Campylobacterota |
| Species | Campylobacter coli 15-537360 [CP006702] |
| Start position on genome | 431096 |
| End posion on genome | 431172 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
ccattattaa |
| tRNA gene sequence |
GGGCCTATAGCTCAGCTGGTTAGAGTGCACCCCTGATAAGGGTGAGGTCACAAGTTCAAG |
| Downstream region at tRNA end position |
tagaagtatc |
| Secondary structure (Cloverleaf model) | >C141007119 Ile GAT
a ACCA tagaagtatc
G - C
G - C
G - C
C - G
C - G
T - A
A - T T G
T T G T T C A
C G A A | | | | | A
T C T C G A C A A G C
G | | | + T T
G G A G T
T T A G AGGTC
C - G
A - T
C - G
C - G
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |