Sequence ID | >W1910443241 |
Genome ID | FWFX01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Roseovarius albus CECT 7450 [FWFX] |
Start position on genome | 97020 |
End posion on genome | 97096 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
catcacgcac |
tRNA gene sequence |
GCACCTGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCAGAGGTTCGAA |
Downstream region at tRNA end position |
tactccccca |
Secondary structure (Cloverleaf model) | >W1910443241 Arg CCG c GCCA tactccccca G - C C - G A - T C - G C - G T - A G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |