Sequence ID | >W1910458538 |
Genome ID | FWNN01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Klebsiella pneumoniae VRCO0469 [FWNN] |
Start position on genome | 494873 |
End posion on genome | 494797 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aagacaatta |
tRNA gene sequence |
GGCTACGTAGCTCAGCTGGTTAGAGCACATCACTCATAATGATGGGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
aattctggac |
Secondary structure (Cloverleaf model) | >W1910458538 Met CAT a ACCA aattctggac G - C G - C C - G T - A A - T C - G G - C T A T T G C C C A C G A A | | | | G T C T C G A C A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T T - A C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |