Sequence ID | >W1910471824 |
Genome ID | FXBN01000003 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanohalophilus portucalensis FDF-1 [FXBN] |
Start position on genome | 166721 |
End posion on genome | 166806 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aataatattT |
tRNA gene sequence |
GCTGAGGTAGTCTAGCGGTACGGCGCAAGCCTGGAAAGCTTGTGGGGCTTGACCCCTCGG |
Downstream region at tRNA end position |
ttctattttt |
Secondary structure (Cloverleaf model) | >W1910471824 Ser GGA T GTCt ttctattttt G - C C - G T - A G - C A - T G - C G - C T A T C C C T C A G A A | | | | | G C T C T G G G G A G C G | + | T T G C G G C T A G TGGGGCTTGACCCCTC C - G A - T A - T G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |