Sequence ID | >C141011945 |
Genome ID | FO203519 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Maridesulfovibrio hydrothermalis [FO203519] |
Start position on genome | 2580582 |
End posion on genome | 2580489 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tctccgcaat |
tRNA gene sequence |
GGAAGTGTATCGTCACCGGTGTGGCGCCTGGACTTCAAATCCAGTGGACGGGTTAACCCT |
Downstream region at tRNA end position |
tctccacttc |
Secondary structure (Cloverleaf model) | >C141011945 SeC TCA t GCCA tctccacttc G - C G - C A - T A - T G - C T - A G - C T - A T C A T A T C C A C C A T + | | | | G G C T G C G T A G G C G | + | | T T T G G C G G T C TGGACGGGTTAACCCTCGTCG C - G T - A G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |