Sequence ID | >W1910503537 |
Genome ID | FYCN01000061 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium psychrophilum JIP 08/99 [FYCN] |
Start position on genome | 10230 |
End posion on genome | 10303 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gcattagcac |
tRNA gene sequence |
GGTACCTTAGCTCAGATGGTAGAGCAATGGACTGAAAATCCATGTGTCCCTGGTTCGATC |
Downstream region at tRNA end position |
aaaaatccct |
Secondary structure (Cloverleaf model) | >W1910503537 Phe GAA c ACaa aaaaatccct G - C G - C T - A A - T C - G C - G T - A C T T G G T C C A A G A A | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC A - T T - A G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |