Sequence ID | >PHG14100066 |
Genome ID | EU710883 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Erwinia phage phiEa21-4 phiSG-JL2 (EU710883) |
Start position on genome | 24745 |
End posion on genome | 24820 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccaaaactat |
tRNA gene sequence |
ACTCGTATAGCTCAGATGGTAGAGCGGCATCTTTACACGTTGCTGGTCAGGCGTTCGAGT |
Downstream region at tRNA end position |
aacaatggct |
Secondary structure (Cloverleaf model) | >PHG14100066 Val TAC t ACCA aacaatggct A - T C - G T - A C - G G - C T + G A - T T G T T C C G C A A G A A | | | | | G T C T C G A G G C G C G | | | | T T G G A G C T A G TGGTC G - C C - G A - T T T C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |