Sequence ID | >PHG14100415 |
Genome ID | HE956708 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Yersinia phage phiR201 TP-J34 (HE956708) |
Start position on genome | 32457 |
End posion on genome | 32384 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccaccaaatt |
tRNA gene sequence |
GCTCGGTTAGTTTAATGGGAGAACCCCGTCTTTACACGGCGGTTGCGATAGTTCGATTCT |
Downstream region at tRNA end position |
attaactcaa |
Secondary structure (Cloverleaf model) | >PHG14100415 Val TAC t ACCA attaactcaa G + T C - G T - A C - G G - C G - C T - A T T T C T A T C A A A A | | | | | G T T T T G G A T A G C G + | | | T T G G A A C G A C TTGC C - G C - G G - C T + G C - G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |