Sequence ID | >PHG14100441 |
Genome ID | HE983845 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Pseudomonas phage vB_PaeM_C2-10_Ab1 (HE983845) |
Start position on genome | 22357 |
End posion on genome | 22433 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccaaattaga |
tRNA gene sequence |
TGGACGGAAGCTAAAGTGGATCAGCATCTGGCTTTTAACCAGACTTATAGTGAGTTCGAG |
Downstream region at tRNA end position |
aatttagtga |
Secondary structure (Cloverleaf model) | >PHG14100441 Lys TTT a ACCA aatttagtga T - A G - C G + T A - T C - G G - C G - C T G A C A C T C A G A A A | | | | | G T A T C G G T G A G C G | | | T T G C A G C A T A CTTATA T - A C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |