Sequence ID | >PHG14100769 |
Genome ID | HQ641380 |
Search identical group | |
Phylum/Class | Podoviridae |
Species | Enterobacter phage EcP1 VBP32 (HQ641380) |
Start position on genome | 55628 |
End posion on genome | 55704 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgaccaatta |
tRNA gene sequence |
GTGCCTTTAGCTCAGACGGTTAGAGCAGCCGACTCATAATCGGTAGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
gaagttgcca |
Secondary structure (Cloverleaf model) | >PHG14100769 Met CAT a ACCA gaagttgcca G - C T + G G - C C - G C - G T + G T - A T A T T G T C C A A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C T T A A AGGTC G + T C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |