Sequence ID | >PHG14100950 |
Genome ID | JF744988 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Mycobacterium virus Faith1 (JF744988) |
Start position on genome | 63326 |
End posion on genome | 63408 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tccagccttt |
tRNA gene sequence |
GTGGTGGTTGGGCTTGTTGGTTGGCCCACCTGACTGTAAATCAGGCGTTTCGGCACCGGG |
Downstream region at tRNA end position |
ttgacaaccc |
Secondary structure (Cloverleaf model) | >PHG14100950 Tyr GTA t ACag ttgacaaccc G - C T - A G - C G - C T - A G - C G - C T T T C T C C C A T G T T T | + | | | G T C G G G G G G G G C G | | | | T T G G C C C T T G A CGTTTCGGCACC C - G C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |