Sequence ID | >PHG14101888 |
Genome ID | JX195166 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Pectobacterium phage My1 (JX195166) |
Start position on genome | 35566 |
End posion on genome | 35489 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacaaatttt |
tRNA gene sequence |
GGTTCCTTAGCTCTAATTGGTTAGAGCGGCATCTTGTTAAGTTGAGGGTTGCTGGTTCGA |
Downstream region at tRNA end position |
aacaatgcga |
Secondary structure (Cloverleaf model) | >PHG14101888 Asn GTT t GCCA aacaatgcga G - C G - C T - A T - A C - G C - G T - A T A T C G A C C A T A A T A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T T A G GGGTT G A C - G A - T T T C - G T A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |