Sequence ID | >PHG14101905 |
Genome ID | JX233784 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Pseudomonas phage PA7 S-CAM20 (JX233784) |
Start position on genome | 41414 |
End posion on genome | 41490 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agaagattcc |
tRNA gene sequence |
GCCGCTATAGCTCAGCTAGGTAGAGCAACGCACTTGTAATGCGTAGGTCCTCCGTTCGAT |
Downstream region at tRNA end position |
aatttactga |
Secondary structure (Cloverleaf model) | >PHG14101905 Thr TGT c ACCA aatttactga G - C C - G C - G G - C C - G T + G A - T T T T G A G G C A C G A A | | | | | G T C T C G C T C C G C A | | | | T T G G A G C G T A A AGGTC A - T C - G G - C C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |