Sequence ID | >PHG14102067 |
Genome ID | KC139543 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Salmonella phage FSL SP-012 TN106 (KC139543) |
Start position on genome | 23103 |
End posion on genome | 23027 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccaaattaat |
tRNA gene sequence |
GCTGCTTTCGTATAATTGGTTATTACACATCCCTTGTAAGGATGGAAATGCGGGTTCGAG |
Downstream region at tRNA end position |
attcagaggt |
Secondary structure (Cloverleaf model) | >PHG14102067 Thr TGT t ACCA attcagaggt G - C C - G T - A G - C C - G T - A T + G T G T T G T C C A T A A C + | + | | G T T A T G G C G G G C G | | | T T G T T A C T T A A GAAAT C - G A - T T - A C - G C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |