Sequence ID | >PHG14102248 |
Genome ID | KC748968 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Mycobacterium phage Gizmo Gb1 (KC748968) |
Start position on genome | 100128 |
End posion on genome | 100204 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccccgttgac |
tRNA gene sequence |
GGGCCGGTATCTTAGTCTGGTCAAAGAAGTGGACTTTTAATCCGCGCGCCGTGGGTTCGA |
Downstream region at tRNA end position |
tcttcgtgtt |
Secondary structure (Cloverleaf model) | >PHG14102248 Lys TTT c ACCc tcttcgtgtt G - C G - C G - C C - G C - G G - C G - C T A T C A C C C A C T G A A | | | | | G T T T C T G T G G G C G | | | | T T G A A G A T C A A GCGCC G - C T + G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |