Sequence ID | >PHG14102275 |
Genome ID | KC787105 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Mycobacterium phage Chy4 Gb1 (KC787105) |
Start position on genome | 4602 |
End posion on genome | 4682 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggactacaaa |
tRNA gene sequence |
CGCGAGATACCCAAGCGGCAACGGGATCTGACTGTAAATCAGACGCTTCGGCTTCGCAGG |
Downstream region at tRNA end position |
gacagccacc |
Secondary structure (Cloverleaf model) | >PHG14102275 Tyr GTA a ACtt gacagccacc C - G G - C C - G G - C A - T G - C A - T T G T C G T C C A C G A A | | | | | G G A C C C G C A G G C G | | | T T C C G G G A A A CGCTTCGGCTTC T - A C - G T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |