Sequence ID | >W1910546984 |
Genome ID | FZNK01000006 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum ezzemoulense DSM 19316 [FZNK] |
Start position on genome | 144725 |
End posion on genome | 144655 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
ctcgatttga |
tRNA gene sequence |
GCACCGTTGGTCCAGTGGTAGGACATTAGCTTCCCAAGCTAATAGCCCGGGTTCAATTCC |
Downstream region at tRNA end position |
ggacgcttac |
Secondary structure (Cloverleaf model) | >W1910546984 Gly CCC a Atcc ggacgcttac G - C C - G A - T C - G C - G G - C T - A T T T G G C C C A G A G | | | | | A T C C T G C C G G G C G | | | | T T G G G A C T A A TAGC T - A T - A A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |