Sequence ID | >W1910547286 |
Genome ID | FZNQ01000022 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halorubrum vacuolatum DSM 8800 [FZNQ] |
Start position on genome | 14121 |
End posion on genome | 14038 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gatgtagcgT |
tRNA gene sequence |
GCCGCCATGCCCGAGTGGTCAAACGGGCACGGTTGAGGGCCGTGTGGTGAGTCCTTCCCA |
Downstream region at tRNA end position |
cggtgattgg |
Secondary structure (Cloverleaf model) | >W1910547286 Leu GAG T ATgc cggtgattgg G - C C - G C - G G - C C - G C - G A - T T A T G G T C C A T G A G | | | | | G G G C C C C C A G G C G | | T T T A C G G C A A G TGGTGAGTCCTTC C - G A - T C - G G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |