Sequence ID | >W1910548976 |
Genome ID | FZOX01000006 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Tardiphaga sp. OK246 [FZOX] |
Start position on genome | 401955 |
End posion on genome | 402039 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gatttcttta |
tRNA gene sequence |
GCGCTCGTGGCGGAATTGGTAGACGCGCTGCCTTGAGGTGGCAGTCCGTAACAGGGTGGG |
Downstream region at tRNA end position |
cagacctcaa |
Secondary structure (Cloverleaf model) | >W1910548976 Leu GAG a ACCA cagacctcaa G - C C - G G - C C - G T - A C - G G - C T G T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TCCGTAACAGGGT C - G T - A G - C C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |