Sequence ID | >W1910550316 |
Genome ID | FZQU01000005 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Helicobacter sp. 'CLO3_human' [FZQU] |
Start position on genome | 280920 |
End posion on genome | 280844 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tattaccgtg |
tRNA gene sequence |
GTGGATGTAGCTCAGTTGGTTAGAGCATCAGGTTGTGGCTCTGAGGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
tcatttttga |
Secondary structure (Cloverleaf model) | >W1910550316 His GTG g CCCA tcatttttga G - C T - A G - C G - C A - T T - A G - C C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G A - T G - C G + T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |