| Sequence ID | >W1910568781 |
| Genome ID | JFZT01000057 |
| Phylum/Class | Thermoproteota |
| Species | Candidatus Acidianus copahuensis copahuensis ALE1 [JFZT] |
| Start position on genome | 113155 |
| End posion on genome | 113080 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
atagattttc |
| tRNA gene sequence |
GCGGTCGTAGTCTAGCATGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA |
| Downstream region at tRNA end position |
gatgtaacta |
| Secondary structure (Cloverleaf model) | >W1910568781 Gly GCC
c Atag gatgtaacta
G - C
C - G
G - C
G - C
T + G
C - G
G - C T A
T G G C C C A
A C G A A | | | | | A
T T C T G C C G G G C
G + | | | T T
G G G A C
A T T A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |