Sequence ID | >W1910569103 |
Genome ID | JHWX01000006 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobrevibacter wolinii SH [JHWX] |
Start position on genome | 4551 |
End posion on genome | 4624 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttttttatat |
tRNA gene sequence |
GCCATCGTAGCTCAGTAGGTAGAGCGTTCGGCTGTTAACCGATTGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
ttgggcccat |
Secondary structure (Cloverleaf model) | >W1910569103 Asn GTT t GCtt ttgggcccat G - C C - G C - G A - T T - A C - G G - C C G T T G T C C A T G A A | | | | | G A C T C G A C A G G C G | | | | T T G G A G C T A G TGGTC T T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |