Sequence ID | >W1910569569 |
Genome ID | JJOX01000079 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina sp. 2.H.T.1A.3 [JJOX] |
Start position on genome | 32360 |
End posion on genome | 32283 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aagtaccctT |
tRNA gene sequence |
GGGATAGTAGGGTAGCTTGGTCCATCCTCGAGCGTTTGGGACGCTTGGACCGCGGTTCAA |
Downstream region at tRNA end position |
ttttttatct |
Secondary structure (Cloverleaf model) | >W1910569569 Pro TGG T ATCa ttttttatct G - C G - C G - C A - T T - A A - T G - C T A T G C G C C A T C G A A | | | | | A T T G G G C G C G G C G | | + T T G T C C T T C C A C GGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |