Sequence ID | >W1910569907 |
Genome ID | JJPE01000065 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei 3.F.A.2.3 [JJPE] |
Start position on genome | 23915 |
End posion on genome | 23839 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
taaacaaact |
tRNA gene sequence |
GGGCCCGTAGCTCAGTCAGGCAGAGCGACTGGCTTTTAACCAGTCGGCCTAGGGTTCAAA |
Downstream region at tRNA end position |
tgttctttat |
Secondary structure (Cloverleaf model) | >W1910569907 Lys TTT t GCCA tgttctttat G - C G - C G - C C - G C - G C - G G - C T A T A T C C C A T G A A | | | | | A C C T C G T A G G G C A | | | | T T G G A G C G C A G CGGCC A - T C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |