Sequence ID | >W1910570645 |
Genome ID | JJPS01000215 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei 3.H.A.2.8 [JJPS] |
Start position on genome | 5985 |
End posion on genome | 5912 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agaccctgtg |
tRNA gene sequence |
GCCGGGGTAGGGTAGAGGTCCATCCTGTGGCCCTGTGGAGGCTACGACCCGAGTTCGATT |
Downstream region at tRNA end position |
aactattttt |
Secondary structure (Cloverleaf model) | >W1910570645 His GTG g CCtt aactattttt G - C C - G C - G G - C G - C G - C G + T T T T G G C T C A A G A A | | | | | G G T G G G C C G A G C G | | + T T T T C C T C C A G CGAC T - A G + T G - C C - G C - G C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |